View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0260_low_27 (Length: 267)

Name: NF0260_low_27
Description: NF0260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0260_low_27
NF0260_low_27
[»] chr2 (1 HSPs)
chr2 (35-222)||(12544113-12544304)


Alignment Details
Target: chr2 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 35 - 222
Target Start/End: Complemental strand, 12544304 - 12544113
Alignment:
35 ggacatcatcatcgaataatcaaattctaatttcactgtagc---tgtcaaatatagtaatagttcataca-cccatgcacgtgaagttttgcaattgta 130  Q
    ||||||||| || |||||||||||||||||||||||||||||   |||||||||||||||||| ||||| | ||||||||||||||||||||||||||||    
12544304 ggacatcatgattgaataatcaaattctaatttcactgtagcaactgtcaaatatagtaataggtcatagaacccatgcacgtgaagttttgcaattgta 12544205  T
131 ggagcaacaatccaaaaattgttgaattcatggaacaacatattattctcatagtactttaaatactacacctccctctcactacaaaatac 222  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||    
12544204 ggagcaacagtccaaaaattgttgaattcatggaacaacatattattctcagagtactttaaatactacacctccctctcacgacaaaatac 12544113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 311 times since January 2019
Visitors: 2564