View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0260_low_33 (Length: 249)
Name: NF0260_low_33
Description: NF0260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0260_low_33 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 40699943 - 40699724
Alignment:
| Q |
1 |
attacatgatattttatttttcattcaattaccacatcagattagcatagtttgacctgagagaatctctctagcaaaacctgcatggtctttgtcagac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40699943 |
attacatgatattttatttttcattcaattaccacatcagattagcatagttttacctgagagaatctctctagcaaaacctgcatggtctttgtcagac |
40699844 |
T |
 |
| Q |
101 |
gccattgcaacaacaaaagctaatcgagctttgggaaacgccatccttattgtattcatcagtgctttggcagattctttggtgtgggctacagaatgaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40699843 |
gccattgcaacaacaaaagctaatcgagctttgggagacgccatctttattgtattcatcagtgctttggcagattctttggtgtgggctacagaatgaa |
40699744 |
T |
 |
| Q |
201 |
tagacataatcataactatg |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
40699743 |
tagacataatcataactatg |
40699724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 4 - 215
Target Start/End: Original strand, 9646980 - 9647190
Alignment:
| Q |
4 |
acatgatattttatttttcattcaattaccacatcagattagcatagtttgacctgagagaatctctctagcaaaacctgcatggtctttgtcagacgcc |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9646980 |
acatgatattttatttttcattcaattaccacatcagattagcatagttt-acctgagagaatctctctagcaaaacctgcatggtctttgtcagacgcc |
9647078 |
T |
 |
| Q |
104 |
attgcaacaacaaaagctaatcgagctttgggaaacgccatccttattgtattcatcagtgctttggcagattctttggtgtgggctacagaatgaatag |
203 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
9647079 |
attgcaacaacaaaagctaattgagccttgggaaacgccatccttattgtattcatcagtgctttggcagattccttggtgtgggctacaggatgaatag |
9647178 |
T |
 |
| Q |
204 |
acataatcataa |
215 |
Q |
| |
|
||| |||||||| |
|
|
| T |
9647179 |
acacaatcataa |
9647190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University