View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0260_low_34 (Length: 248)

Name: NF0260_low_34
Description: NF0260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0260_low_34
NF0260_low_34
[»] chr2 (2 HSPs)
chr2 (113-226)||(32425592-32425705)
chr2 (184-226)||(32421305-32421347)
[»] chr1 (1 HSPs)
chr1 (184-226)||(1543630-1543672)


Alignment Details
Target: chr2 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 113 - 226
Target Start/End: Complemental strand, 32425705 - 32425592
Alignment:
113 gcagagacgtgtccagcttgatttggaggaacgtatccgccttaatttggagtagcgtaagcgttgaaggtgagcattgttcctaacccacacctcatga 212  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32425705 gcagaggcgtgtccagcttgatttggaggaacgtatccgccttaatttggagtagcgtaagcgttgaaggtgagcattgttcctaacccacacctcatga 32425606  T
213 tacttaggatcata 226  Q
    ||||||||||||||    
32425605 tacttaggatcata 32425592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 184 - 226
Target Start/End: Complemental strand, 32421347 - 32421305
Alignment:
184 gagcattgttcctaacccacacctcatgatacttaggatcata 226  Q
    |||||||||||||||||||| ||||||||||||| ||||||||    
32421347 gagcattgttcctaacccactcctcatgatacttgggatcata 32421305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 184 - 226
Target Start/End: Complemental strand, 1543672 - 1543630
Alignment:
184 gagcattgttcctaacccacacctcatgatacttaggatcata 226  Q
    |||||||||||||||||||| ||||||||||||| ||||||||    
1543672 gagcattgttcctaacccactcctcatgatacttgggatcata 1543630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University