View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0260_low_37 (Length: 236)

Name: NF0260_low_37
Description: NF0260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0260_low_37
NF0260_low_37
[»] chr4 (1 HSPs)
chr4 (104-236)||(11024091-11024223)


Alignment Details
Target: chr4 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 104 - 236
Target Start/End: Complemental strand, 11024223 - 11024091
Alignment:
104 taaccattggtactccggaacttattgcttccacggtcgcgttccagccacaatgcgttaagaatccgcctatcgatggatgatccaatattaacgcttg 203  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11024223 taaccattggtactccggaacttattgcttccacggtcgcgttccagccacaatgcgttaagaatccgcctatcgatggatgatccaatattaacgcttg 11024124  T
204 tggaacccatcctttaatcaacattcctttctt 236  Q
    |||||||||||||||||||||||||||||||||    
11024123 tggaacccatcctttaatcaacattcctttctt 11024091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University