View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0260_low_38 (Length: 203)
Name: NF0260_low_38
Description: NF0260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0260_low_38 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 107; Significance: 8e-54; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 1 - 107
Target Start/End: Complemental strand, 49520810 - 49520704
Alignment:
| Q |
1 |
catcagttcaggcaatattagattggcaaagaaggaccatggagatgatgtatactgagattgctgatgccataaaaaagaagaacattgaagcacaccc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49520810 |
catcagttcaggcaatattagattggcaaagaaggaccatggagatgatgtatactgagattgctgatgccataaaaaagaagaacattgaagcacaccc |
49520711 |
T |
|
| Q |
101 |
tcgtgat |
107 |
Q |
| |
|
||||||| |
|
|
| T |
49520710 |
tcgtgat |
49520704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 3 - 67
Target Start/End: Complemental strand, 49509662 - 49509598
Alignment:
| Q |
3 |
tcagttcaggcaatattagattggcaaagaaggaccatggagatgatgtatactgagattgctga |
67 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| ||||||||||||||| |||| |||||||| |
|
|
| T |
49509662 |
tcagttcaagcaatattagattggcaaagaaggactatggagatgatgtattctgacattgctga |
49509598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 831 times since January 2019
Visitors: 2568