View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0260_low_9 (Length: 364)
Name: NF0260_low_9
Description: NF0260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0260_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 10 - 268
Target Start/End: Complemental strand, 11696140 - 11695882
Alignment:
Q |
10 |
aagaaaataccacatttcaaaacatgggcatgaacttgcttaaattcttccatactattgcatcttttgagtaaacataaccatcttttttcattgaaac |
109 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11696140 |
aagaaaataccacatttcaaaacatgggcatgaacttgcttaaattcttccatactattgcatcttttgagtaaacataaccatcttttttcattgaaac |
11696041 |
T |
 |
Q |
110 |
tattgctcaattcaatgctatagggttgattatttggtagtgatgaaaaatgagtttggctaaggacaattgtcccagtcatcctttcagtgacagtatc |
209 |
Q |
|
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
11696040 |
tattgcacaattcaatgctatagggttgattatttggtagtgatgaaaaatgagtttggctaaggacaattgtcccagtcatcctttcagtgatagtatc |
11695941 |
T |
 |
Q |
210 |
atgttatgttgctaaaactaaaaatacactttgtaacctatttattcacttggaataat |
268 |
Q |
|
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
11695940 |
atgttatgttgctaaaactaaaactacactttgtaacctatttattcacttggaataat |
11695882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 180 times since January 2019
Visitors: 2563