View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0261-INSERTION-23 (Length: 182)
Name: NF0261-INSERTION-23
Description: NF0261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0261-INSERTION-23 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 4e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 4e-89
Query Start/End: Original strand, 1 - 182
Target Start/End: Original strand, 13275397 - 13275578
Alignment:
Q |
1 |
aaggttctcgaggacgttgtctaggttttctgtagcgcagtcaacaatattgcgataccataatttcagccaacaaaaaataagtcctacaaatgtaaca |
100 |
Q |
|
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13275397 |
aaggttctcaaggacgttgtctaggttttctgtagcgcagtcaacaatattgcgataccataatttcagccaacaaaaaataagtcctacaaatgtaaca |
13275496 |
T |
 |
Q |
101 |
ctctaatgaaatttgaatccacggaaaggagaaaaaagcttgaccagtggcaggactaggttcaatagatccccagaaaaag |
182 |
Q |
|
|
||||||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
13275497 |
ctctaatgaaatttgaatccagggaaaggagaataaagcttgaccagtagcaggactaggttcaatagatccccagaaaaag |
13275578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University