View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0261-INSERTION-9 (Length: 345)
Name: NF0261-INSERTION-9
Description: NF0261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0261-INSERTION-9 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 10 - 345
Target Start/End: Original strand, 29242404 - 29242739
Alignment:
Q |
10 |
tggtaaaagaacttctccnnnnnnnncaatttggactattgtgtttgtcatacactttctttcatctcattagtgcctcacatgaggggaccaatgttaa |
109 |
Q |
|
|
|||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29242404 |
tggtaaaagaacttctccttttttttcaatttggactattgtgtttgtcacacactttctttcatctcattagtgcctcacatgaggggaccaatgttaa |
29242503 |
T |
 |
Q |
110 |
aattaggttacannnnnnncatttctttcccctatgctatacattagattcagaatgtgtgtctctgtgactctgtttatattatgtctttgatagggaa |
209 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29242504 |
aattaggttacatttttttcatttctttcccctatgctatacattagattcagaatgtgtgtctctgtgactctgtttatattatgtctttgatagggaa |
29242603 |
T |
 |
Q |
210 |
agtcaattctctctatacatgtatgctttcattaactcaacagttgctttccattcgtaccttcacatttataaatgagaaatatatatagagtttttct |
309 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
29242604 |
agtcaattctctctatatatgtatgctttcattaactcaacagttgctttccattcgtaccttcacatttataaatgagaaatatatatagggtttttct |
29242703 |
T |
 |
Q |
310 |
atcttgtacaaacatgcrtatattaaagttgacaat |
345 |
Q |
|
|
||||||||||||||||| |||||||||||||||||| |
|
|
T |
29242704 |
atcttgtacaaacatgcatatattaaagttgacaat |
29242739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University