View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0261_high_7 (Length: 301)
Name: NF0261_high_7
Description: NF0261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0261_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 5e-99; HSPs: 9)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 93 - 283
Target Start/End: Complemental strand, 566798 - 566608
Alignment:
Q |
93 |
gacttttatttacctgatgactgttgggaacgtgtcttcaaattcatcgtcaccaacaaattcatcatcagcaacgaatacagaaacaagaatcgtgata |
192 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
566798 |
gacttttatttacctgatgactgttgggaacgtgtcttcaaattcatcgtcaccaacaaattcatcatcagcaacgaatacagaaacaagaatcgtgata |
566699 |
T |
 |
Q |
193 |
attacttgatattgaattctctctccttagtctccaaacagtttctctccatcaccgaccgtcttcgattttcacttgctatctgtgctcc |
283 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
T |
566698 |
attacttgatattgaattctctctccttagtctccaaacagtttctctccatcaccgacagtcttcgattttcacttgctatctgtactcc |
566608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 210 - 262
Target Start/End: Complemental strand, 5035680 - 5035628
Alignment:
Q |
210 |
tctctctccttagtctccaaacagtttctctccatcaccgaccgtcttcgatt |
262 |
Q |
|
|
||||| ||||| || || ||||||||||||||||||||| ||||||||||||| |
|
|
T |
5035680 |
tctctttccttcgtttcaaaacagtttctctccatcaccaaccgtcttcgatt |
5035628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 211 - 265
Target Start/End: Complemental strand, 12124881 - 12124827
Alignment:
Q |
211 |
ctctctccttagtctccaaacagtttctctccatcaccgaccgtcttcgattttc |
265 |
Q |
|
|
|||||||| | ||||||||||| ||||||||||||||| ||||||| | |||||| |
|
|
T |
12124881 |
ctctctccattgtctccaaacaatttctctccatcaccaaccgtctccaattttc |
12124827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 96 - 137
Target Start/End: Original strand, 1523994 - 1524035
Alignment:
Q |
96 |
ttttatttacctgatgactgttgggaacgtgtcttcaaattc |
137 |
Q |
|
|
||||| ||||||||||||||||||||| ||||||||||||| |
|
|
T |
1523994 |
ttttacttacctgatgactgttgggaatctgtcttcaaattc |
1524035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 211 - 256
Target Start/End: Complemental strand, 12126937 - 12126892
Alignment:
Q |
211 |
ctctctccttagtctccaaacagtttctctccatcaccgaccgtct |
256 |
Q |
|
|
|||||||| | ||||||||||| ||||||||||||||| ||||||| |
|
|
T |
12126937 |
ctctctccattgtctccaaacaatttctctccatcaccaaccgtct |
12126892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 222 - 262
Target Start/End: Original strand, 2367689 - 2367729
Alignment:
Q |
222 |
gtctccaaacagtttctctccatcaccgaccgtcttcgatt |
262 |
Q |
|
|
||||||||||| ||||||||||||||| ||||||| ||||| |
|
|
T |
2367689 |
gtctccaaacaatttctctccatcaccaaccgtctccgatt |
2367729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 210 - 262
Target Start/End: Complemental strand, 2460655 - 2460603
Alignment:
Q |
210 |
tctctctccttagtctccaaacagtttctctccatcaccgaccgtcttcgatt |
262 |
Q |
|
|
||||||||| | |||||||||||||| |||||||||||| | ||||| ||||| |
|
|
T |
2460655 |
tctctctccatggtctccaaacagttcctctccatcaccaatcgtctccgatt |
2460603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 210 - 262
Target Start/End: Complemental strand, 2486365 - 2486313
Alignment:
Q |
210 |
tctctctccttagtctccaaacagtttctctccatcaccgaccgtcttcgatt |
262 |
Q |
|
|
||||||||| | ||||| ||||||||||| ||||||||| ||||||| ||||| |
|
|
T |
2486365 |
tctctctccctcgtctcaaaacagtttctgtccatcaccaaccgtctccgatt |
2486313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 210 - 262
Target Start/End: Complemental strand, 2525815 - 2525763
Alignment:
Q |
210 |
tctctctccttagtctccaaacagtttctctccatcaccgaccgtcttcgatt |
262 |
Q |
|
|
||||||||| | ||||| ||||||||||| ||||||||| || |||||||||| |
|
|
T |
2525815 |
tctctctccctcgtctcaaaacagtttctgtccatcaccaacagtcttcgatt |
2525763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 56; Significance: 3e-23; HSPs: 9)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 184 - 283
Target Start/End: Complemental strand, 12097495 - 12097396
Alignment:
Q |
184 |
atcgtgataattacttgatattgaattctctctccttagtctccaaacagtttctctccatcaccgaccgtcttcgattttcacttgctatctgtgctcc |
283 |
Q |
|
|
|||||||| |||||||| |||||||||||||| |||||||||||||| ||||||| ||||| ||||||||||||||||||||| |||||||| |||| |
|
|
T |
12097495 |
atcgtgatcgttacttgactttgaattctctctctttagtctccaaacaatttctcttcatcagagaccgtcttcgattttcacttactatctgtactcc |
12097396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 216 - 256
Target Start/End: Complemental strand, 6437201 - 6437161
Alignment:
Q |
216 |
tccttagtctccaaacagtttctctccatcaccgaccgtct |
256 |
Q |
|
|
|||||||||||||||||||| |||||||||||| ||||||| |
|
|
T |
6437201 |
tccttagtctccaaacagttcctctccatcaccaaccgtct |
6437161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 204 - 268
Target Start/End: Complemental strand, 7132607 - 7132543
Alignment:
Q |
204 |
ttgaattctctctccttagtctccaaacagtttctctccatcaccgaccgtcttcgattttcact |
268 |
Q |
|
|
||||||||||| || || ||||||||| |||| |||||||||| |||||||| |||||| ||||| |
|
|
T |
7132607 |
ttgaattctctttcttttgtctccaaagagttcctctccatcatcgaccgtcgtcgattctcact |
7132543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 204 - 268
Target Start/End: Complemental strand, 7135530 - 7135466
Alignment:
Q |
204 |
ttgaattctctctccttagtctccaaacagtttctctccatcaccgaccgtcttcgattttcact |
268 |
Q |
|
|
||||||||||| || || ||||||||| |||| |||||||||| |||||||| |||||| ||||| |
|
|
T |
7135530 |
ttgaattctctttcttttgtctccaaagagttcctctccatcatcgaccgtcgtcgattctcact |
7135466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 210 - 268
Target Start/End: Complemental strand, 6395833 - 6395775
Alignment:
Q |
210 |
tctctctccttagtctccaaacagtttctctccatcaccgaccgtcttcgattttcact |
268 |
Q |
|
|
||||||||| | |||||||| ||||| |||||||||||| | | ||||||||||||||| |
|
|
T |
6395833 |
tctctctccctcgtctccaagcagttcctctccatcaccaatcatcttcgattttcact |
6395775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 96 - 137
Target Start/End: Complemental strand, 9412495 - 9412454
Alignment:
Q |
96 |
ttttatttacctgatgactgttgggaacgtgtcttcaaattc |
137 |
Q |
|
|
||||||||||||||||| ||||||||| || ||||||||||| |
|
|
T |
9412495 |
ttttatttacctgatgaatgttgggaaagtatcttcaaattc |
9412454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 99 - 140
Target Start/End: Complemental strand, 14810082 - 14810041
Alignment:
Q |
99 |
tatttacctgatgactgttgggaacgtgtcttcaaattcatc |
140 |
Q |
|
|
|||||||||||||| ||||||||||||||||| | ||||||| |
|
|
T |
14810082 |
tatttacctgatgagtgttgggaacgtgtctttagattcatc |
14810041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 212 - 269
Target Start/End: Complemental strand, 14821678 - 14821621
Alignment:
Q |
212 |
tctctccttagtctccaaacagtttctctccatcaccgaccgtcttcgattttcactt |
269 |
Q |
|
|
||||||| | |||||||| ||||| ||||| |||||| | |||||||||||||||||| |
|
|
T |
14821678 |
tctctccctcgtctccaagcagttcctctctatcaccaatcgtcttcgattttcactt |
14821621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 204 - 268
Target Start/End: Complemental strand, 6427486 - 6427422
Alignment:
Q |
204 |
ttgaattctctctccttagtctccaaacagtttctctccatcaccgaccgtcttcgattttcact |
268 |
Q |
|
|
|||| |||||||||| | |||||||| ||||| |||||||||||| | ||||||| | ||||||| |
|
|
T |
6427486 |
ttgagttctctctccctcgtctccaagcagttcctctccatcaccaatcgtcttcaaatttcact |
6427422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000002; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 204 - 265
Target Start/End: Original strand, 15091350 - 15091411
Alignment:
Q |
204 |
ttgaattctctctccttagtctccaaacagtttctctccatcaccgaccgtcttcgattttc |
265 |
Q |
|
|
||||||||||||||| | |||||||||||||| |||||||||||| || |||||| |||||| |
|
|
T |
15091350 |
ttgaattctctctccctcgtctccaaacagttcctctccatcaccaacagtcttctattttc |
15091411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 204 - 268
Target Start/End: Original strand, 10168807 - 10168871
Alignment:
Q |
204 |
ttgaattctctctccttagtctccaaacagtttctctccatcaccgaccgtcttcgattttcact |
268 |
Q |
|
|
||||||||||| ||| | |||||||||||||| |||||||||||| || ||||||||| ||||| |
|
|
T |
10168807 |
ttgaattctctatcccttgtctccaaacagttcctctccatcaccaacactcttcgattatcact |
10168871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 204 - 268
Target Start/End: Original strand, 10176332 - 10176396
Alignment:
Q |
204 |
ttgaattctctctccttagtctccaaacagtttctctccatcaccgaccgtcttcgattttcact |
268 |
Q |
|
|
||||||||||| ||| | |||||||||||||| |||||||||||| || ||||||||| ||||| |
|
|
T |
10176332 |
ttgaattctctatcccttgtctccaaacagttcctctccatcaccaacactcttcgattatcact |
10176396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 210 - 268
Target Start/End: Complemental strand, 7978165 - 7978108
Alignment:
Q |
210 |
tctctctccttagtctccaaacagtttctctccatcaccgaccgtcttcgattttcact |
268 |
Q |
|
|
||||||||||| ||||| | |||||||||||||||||| |||||||| |||||||||| |
|
|
T |
7978165 |
tctctctccttcgtctc-atgcagtttctctccatcaccaaccgtcttagattttcact |
7978108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 99 - 137
Target Start/End: Original strand, 51120330 - 51120368
Alignment:
Q |
99 |
tatttacctgatgactgttgggaacgtgtcttcaaattc |
137 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||||| |
|
|
T |
51120330 |
tatttacctgatgactgttgggaatgtgtcttcaaattc |
51120368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 204 - 268
Target Start/End: Original strand, 51763147 - 51763211
Alignment:
Q |
204 |
ttgaattctctctccttagtctccaaacagtttctctccatcaccgaccgtcttcgattttcact |
268 |
Q |
|
|
||||||||||||||| | || ||||||||||| |||||||||||| ||||| | ||||| ||||| |
|
|
T |
51763147 |
ttgaattctctctccatcgtttccaaacagttcctctccatcacccaccgtttccgattctcact |
51763211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000004; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 213 - 262
Target Start/End: Complemental strand, 32268825 - 32268776
Alignment:
Q |
213 |
ctctccttagtctccaaacagtttctctccatcaccgaccgtcttcgatt |
262 |
Q |
|
|
|||||| | |||||||||||||| |||||||||||| ||||||||||||| |
|
|
T |
32268825 |
ctctccatcgtctccaaacagttactctccatcaccaaccgtcttcgatt |
32268776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 204 - 279
Target Start/End: Original strand, 41900251 - 41900326
Alignment:
Q |
204 |
ttgaattctctctccttagtctccaaacagtttctctccatcaccgaccgtcttcgattttcacttgctatctgtg |
279 |
Q |
|
|
||||| |||||||| | ||||||||||||||||||||||||||| || ||||||||| || ||| | ||||||| |
|
|
T |
41900251 |
ttgaaatctctctcactcgtctccaaacagtttctctccatcaccaacactcttcgattctctcttacaatctgtg |
41900326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 99 - 137
Target Start/End: Original strand, 41886296 - 41886334
Alignment:
Q |
99 |
tatttacctgatgactgttgggaacgtgtcttcaaattc |
137 |
Q |
|
|
|||||||||||||| ||||||||| |||||||||||||| |
|
|
T |
41886296 |
tatttacctgatgagtgttgggaatgtgtcttcaaattc |
41886334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 222 - 262
Target Start/End: Original strand, 15837976 - 15838016
Alignment:
Q |
222 |
gtctccaaacagtttctctccatcaccgaccgtcttcgatt |
262 |
Q |
|
|
||||||||||||||||||||||||||| ||||||| ||||| |
|
|
T |
15837976 |
gtctccaaacagtttctctccatcaccaaccgtctccgatt |
15838016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 204 - 268
Target Start/End: Complemental strand, 33161497 - 33161433
Alignment:
Q |
204 |
ttgaattctctctccttagtctccaaacagtttctctccatcaccgaccgtcttcgattttcact |
268 |
Q |
|
|
||||||||||| ||| | |||||||||||||||||||||||||| | |||||||||| ||||| |
|
|
T |
33161497 |
ttgaattctctatccctcgtctccaaacagtttctctccatcactaatagtcttcgattctcact |
33161433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 96 - 133
Target Start/End: Complemental strand, 7561384 - 7561347
Alignment:
Q |
96 |
ttttatttacctgatgactgttgggaacgtgtcttcaa |
133 |
Q |
|
|
|||||||||||||||||||||||| ||| ||||||||| |
|
|
T |
7561384 |
ttttatttacctgatgactgttggaaacatgtcttcaa |
7561347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 204 - 262
Target Start/End: Complemental strand, 32152270 - 32152212
Alignment:
Q |
204 |
ttgaattctctctccttagtctccaaacagtttctctccatcaccgaccgtcttcgatt |
262 |
Q |
|
|
|||||||| |||||| | |||||||||||||| |||||||||||| || |||| ||||| |
|
|
T |
32152270 |
ttgaattcactctccctcgtctccaaacagttcctctccatcaccaacagtctccgatt |
32152212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University