View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0261_low_10 (Length: 300)
Name: NF0261_low_10
Description: NF0261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0261_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 49 - 256
Target Start/End: Original strand, 38831499 - 38831706
Alignment:
| Q |
49 |
aaaatcttaaaaacctcagaacttttacttctagctgcagcatacaaaatatcagtaacaccatactcaccttctccaaaaacaagagaagattctctcc |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38831499 |
aaaatcttaaaaacctcagaacttttacttctagctgcagcatacaaaatatcagtaacaccatactcaccttctccaaaaacaagagaagattctctcc |
38831598 |
T |
|
| Q |
149 |
tcaacaattcacaaacaaattccatatcaccagctgaagcagcagtgtaaagaagccatccaccatatccagctttaaccaaagagtttcttcttttctg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38831599 |
tcaacaattcacaaacaaattccatatcaccagctgaagcagcagtgtaaagaagccatccaccatatccagctttaaccaaagagtttcttcttttctg |
38831698 |
T |
|
| Q |
249 |
gttttttc |
256 |
Q |
| |
|
|||||||| |
|
|
| T |
38831699 |
gttttttc |
38831706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 61 - 219
Target Start/End: Complemental strand, 34397296 - 34397138
Alignment:
| Q |
61 |
acctcagaacttttacttctagctgcagcatacaaaatatcagtaacaccatactcaccttctccaaaaacaagagaagattctctcctcaacaattcac |
160 |
Q |
| |
|
||||||||| | ||||| |||||||||||||| || |||||||||||||||||||| ||||| |||||||| | |||| ||||| |||||||||||| |
|
|
| T |
34397296 |
acctcagaattcttactcctagctgcagcataaaacatatcagtaacaccatactctccttcaccaaaaaccaacaaagaatctcttctcaacaattcat |
34397197 |
T |
|
| Q |
161 |
aaacaaattccatatcaccagctgaagcagcagtgtaaagaagccatccaccatatcca |
219 |
Q |
| |
|
||||||| |||| ||||||||| |||||||||||||| | ||||||||||||||||||| |
|
|
| T |
34397196 |
aaacaaactccaaatcaccagcagaagcagcagtgtacaaaagccatccaccatatcca |
34397138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 659 times since January 2019
Visitors: 2568