View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0261_low_14 (Length: 280)
Name: NF0261_low_14
Description: NF0261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0261_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 178 - 243
Target Start/End: Complemental strand, 5122940 - 5122876
Alignment:
Q |
178 |
caagcttagcaaaaacaacgcacaccaagatttcattaagattcatttttaggttttcttctctct |
243 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5122940 |
caagcttagcaaaaaca-cgcacaccaagatttcattaagattcatttttaggttttcttctctct |
5122876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 51 - 91
Target Start/End: Complemental strand, 5123067 - 5123027
Alignment:
Q |
51 |
acatcatcaaacaacacaaacttacttagtactattattta |
91 |
Q |
|
|
|||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
5123067 |
acatcatcaaacaacacaaagttacttagtactattattta |
5123027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University