View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0263-INSERTION-10 (Length: 159)
Name: NF0263-INSERTION-10
Description: NF0263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0263-INSERTION-10 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 122; Significance: 6e-63; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 122; E-Value: 6e-63
Query Start/End: Original strand, 22 - 159
Target Start/End: Complemental strand, 10255233 - 10255096
Alignment:
| Q |
22 |
acatttgacatgtgagccatggattgaacccacatttctctattcataacttattgtgtgttagttttggcattaaactctttaggaagaagaaagagaa |
121 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10255233 |
acatttgacatgtgagccgtggatagaacccacatttctctattcataacttattttgtgttagttttggcattaaactctttaggaagaagaaagagaa |
10255134 |
T |
|
| Q |
122 |
gagtaagaatcaaattaagaagacgaccaatctgaagc |
159 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
10255133 |
gagtaagaatcaaattaagaagacgactaatctgaagc |
10255096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 389 times since January 2019
Visitors: 2564