View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0263-INSERTION-7 (Length: 213)
Name: NF0263-INSERTION-7
Description: NF0263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0263-INSERTION-7 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 8 - 213
Target Start/End: Complemental strand, 43907785 - 43907580
Alignment:
| Q |
8 |
tgaaataccgttatggtgtctgttacttttatataggttcaggttgatcatggaagaggtggggctgctttcaaattcaacataatttggaacagaatca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43907785 |
tgaaataccgttatggtgtctgttacttttatataggttcaggttgatcatggaagaggtggggctgctttcaaattcaacataatttggaacagaatca |
43907686 |
T |
|
| Q |
108 |
acaacatttcttgattgaaagttttcttgaaacgctcccatctctttattttcgaagtcagaaacttgcggcgattgatgcatagacaatgtttcggaac |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43907685 |
acaacatttcttgattgaaagttttcttgaaacgctcccacctctttattttcgaagtcagaaacttgcggcgattgatgcatagacaatgtttcggaac |
43907586 |
T |
|
| Q |
208 |
aatcat |
213 |
Q |
| |
|
|||||| |
|
|
| T |
43907585 |
aatcat |
43907580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 239 times since January 2019
Visitors: 2563