View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0263-INSERTION-8 (Length: 149)
Name: NF0263-INSERTION-8
Description: NF0263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0263-INSERTION-8 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 134; Significance: 4e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 134; E-Value: 4e-70
Query Start/End: Original strand, 8 - 149
Target Start/End: Complemental strand, 1726620 - 1726479
Alignment:
Q |
8 |
ctacatatattgtatatttcttagcaaatcttctgagtaaagaatataatcaaatgaataataatgcaggaaatatttattaatagcttgagttttacac |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
T |
1726620 |
ctacatatattgtatatttcttagcaaatcttctaagtaaagaatataatcaaatgaataataatgcaggaaatatttattaatagcttgagttttactc |
1726521 |
T |
 |
Q |
108 |
ctcactcagttctcaagtactaatgctcatttgtcaccaaat |
149 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1726520 |
ctcactcagttctcaagtactaatgctcatttgtcaccaaat |
1726479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 204 times since January 2019
Visitors: 2563