View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0263_high_16 (Length: 225)
Name: NF0263_high_16
Description: NF0263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0263_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 9 - 93
Target Start/End: Original strand, 3959196 - 3959280
Alignment:
| Q |
9 |
cttacactcttcattgcagcagtactatgattgtttacctggtcttcatctctagcaacatgggcagtagccgtgtccatctgtg |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3959196 |
cttacactcttcattgcagcagtactatgattgtttacctggtcttcatctctagcaacatgggcagtagccgtgtccatctgtg |
3959280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 12 - 93
Target Start/End: Complemental strand, 19167998 - 19167917
Alignment:
| Q |
12 |
acactcttcattgcagcagtactatgattgtttacctggtcttcatctctagcaacatgggcagtagccgtgtccatctgtg |
93 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| ||||||| |||||||||||||||| |||||||||| ||||||| |
|
|
| T |
19167998 |
acactcttcattgcagcagtactaggattgtttacctgatcttcatatctagcaacatgggcaatagccgtgtcaatctgtg |
19167917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University