View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0263_high_20 (Length: 201)
Name: NF0263_high_20
Description: NF0263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0263_high_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 1 - 119
Target Start/End: Original strand, 12694228 - 12694346
Alignment:
Q |
1 |
aataagaaattgatttaacatgatcagcagaacaacatccggtgcaatgaagagtgatgacttctagcagtttgatgttctatgtgagggcacatatcat |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
12694228 |
aataagaaattgatttaacatgatcagcagaacaacatccggtgcaatgaagagtgatgacttctagcagtttgatgttctatgcgagggcacatatcat |
12694327 |
T |
 |
Q |
101 |
gccgtgggaactttatatt |
119 |
Q |
|
|
||||||||||||||||||| |
|
|
T |
12694328 |
gccgtgggaactttatatt |
12694346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 48 - 92
Target Start/End: Complemental strand, 42448129 - 42448085
Alignment:
Q |
48 |
tgaagagtgatgacttctagcagtttgatgttctatgtgagggca |
92 |
Q |
|
|
|||||||||| ||||| ||||||||||||||||||| ||||||| |
|
|
T |
42448129 |
tgaagagtgacgactttgagcagtttgatgttctatgcgagggca |
42448085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University