View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0263_high_5 (Length: 326)
Name: NF0263_high_5
Description: NF0263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0263_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 9 - 207
Target Start/End: Original strand, 41735103 - 41735301
Alignment:
| Q |
9 |
gaagaatatatgactatcgcccatcactagtgaaaaatgggaattacaagataaaagacattttcgcaattaaattgatgtcgagaaccattgtaaatcg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41735103 |
gaagaatatatgactatcgcccatcactagtgcaaaatgggaattacaagataaaagacattttcgcaattaaattgatgtcgagaaccattgtaaatcg |
41735202 |
T |
 |
| Q |
109 |
gtcatttaaatatattgaactattgttgttacattgtttagtgtacactttcggtatagatcgtcacattggtattcaatttcaaggagtcggctaagg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41735203 |
gtcatttaaatatattgaactattgttgttacattgtttagtgtacactttcggtatagatcgtcacattggtattcaatttcaaggagtcggctaagg |
41735301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 260 - 297
Target Start/End: Original strand, 41735298 - 41735335
Alignment:
| Q |
260 |
aaggtcgatcactaatttgattgaaaacacattgcaga |
297 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41735298 |
aaggtcgaccactaatttgattgaaaacacattgcaga |
41735335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University