View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0263_high_9 (Length: 283)
Name: NF0263_high_9
Description: NF0263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0263_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 68 - 236
Target Start/End: Complemental strand, 9304503 - 9304335
Alignment:
Q |
68 |
atgaccactgtgacaattggaatcacacgcatgcttcccacaacgtagcttctttccacatggaatggaacatagatgtggatccgaatccgttgcattt |
167 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9304503 |
atgaccactgtgacaattggaatcacacgcatgcttcccacaacgtagcttctttccacatggaatggaacatagatgtggatccgaatccgttgcattt |
9304404 |
T |
 |
Q |
168 |
agaatattatttggattagagagtggacaacaccgttcactacaacgatgccttccacaattccttttc |
236 |
Q |
|
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9304403 |
agaatattatttggattagagagcggacaacaccgttcactacaacgatgccttccacaattccttttc |
9304335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University