View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0263_low_16 (Length: 283)

Name: NF0263_low_16
Description: NF0263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0263_low_16
NF0263_low_16
[»] chr4 (1 HSPs)
chr4 (68-236)||(9304335-9304503)


Alignment Details
Target: chr4 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 68 - 236
Target Start/End: Complemental strand, 9304503 - 9304335
Alignment:
68 atgaccactgtgacaattggaatcacacgcatgcttcccacaacgtagcttctttccacatggaatggaacatagatgtggatccgaatccgttgcattt 167  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9304503 atgaccactgtgacaattggaatcacacgcatgcttcccacaacgtagcttctttccacatggaatggaacatagatgtggatccgaatccgttgcattt 9304404  T
168 agaatattatttggattagagagtggacaacaccgttcactacaacgatgccttccacaattccttttc 236  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
9304403 agaatattatttggattagagagcggacaacaccgttcactacaacgatgccttccacaattccttttc 9304335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University