View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0263_low_19 (Length: 257)
Name: NF0263_low_19
Description: NF0263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0263_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 5 - 228
Target Start/End: Original strand, 45330709 - 45330919
Alignment:
Q |
5 |
ggagatagagcttttgtgtgtaattttgatatgcaacatataaatattgttcatcttttcctcttaatgttatttaacagctaccaaacatttctaggat |
104 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| ||||||||||||||||| || | |
|
|
T |
45330709 |
ggagatagagcttttgtgtgtaattttgatatgcaacgtagaaatattgttcatcttttcctcttgatgttatttaacagctaaca-------------t |
45330795 |
T |
 |
Q |
105 |
ggcaccgacactagtgggtgacgatcctgctctacaacttgaagcgactactaaactgaaaagtatataataatatggtatggataatgtagagatatca |
204 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | |
|
|
T |
45330796 |
ggcaccgacactagtgggtgacgatcctgctctgcaacttgaagcgactactaaactgaaaagtatataataatatggtatgtataatgtagagatataa |
45330895 |
T |
 |
Q |
205 |
taagacaattttgaaagatgagaa |
228 |
Q |
|
|
|||||||||||||||||||||||| |
|
|
T |
45330896 |
taagacaattttgaaagatgagaa |
45330919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 791 times since January 2019
Visitors: 2568