View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0263_low_26 (Length: 213)

Name: NF0263_low_26
Description: NF0263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0263_low_26
NF0263_low_26
[»] chr3 (1 HSPs)
chr3 (87-185)||(18389760-18389858)


Alignment Details
Target: chr3 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 87 - 185
Target Start/End: Complemental strand, 18389858 - 18389760
Alignment:
87 atggcaagaataatgagaagtggcttgttaaatcttttactattagtggtcttatttacaaatttattacactgttttgatgctcagcctgtgccaact 185  Q
    ||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18389858 atggcaagaataatgagaagtagcttcttaaatcttttactattagtggtcttatttacaaatttattacactgttttgatgctcagcctgtgccaact 18389760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University