View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0263_low_27 (Length: 213)
Name: NF0263_low_27
Description: NF0263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0263_low_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 92; Significance: 7e-45; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 86 - 185
Target Start/End: Complemental strand, 18389859 - 18389760
Alignment:
| Q |
86 |
aatggcaagaataatgagaagtggcttgttaaatcttttactattagtggtcttatttacaaatttattacactgttttgatgctcagcctgtgccaact |
185 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18389859 |
aatggcaagaataatgagaagtagcttcttaaatcttttactattagtggtcttatttacaaatttattacactgttttgatgctcagcctgtgccaact |
18389760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 940 times since January 2019
Visitors: 2569