View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0263_low_28 (Length: 212)

Name: NF0263_low_28
Description: NF0263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0263_low_28
NF0263_low_28
[»] chr6 (1 HSPs)
chr6 (8-98)||(1863462-1863552)


Alignment Details
Target: chr6 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 1863552 - 1863462
Alignment:
8 ggtaaacctttgataacttatcaagtcttaatattaacccaactatgaaaagtcatgtgctcctcgaacctagctactgattcgaaatatt 98  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1863552 ggtaaacctttgataacttatcaagtcttaatattaacccaactatgaaaagtcatgtgctcctcgaacctagctactgattcgaaatatt 1863462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University