View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0263_low_29 (Length: 209)
Name: NF0263_low_29
Description: NF0263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0263_low_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 77; Significance: 6e-36; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 3 - 104
Target Start/End: Complemental strand, 49971939 - 49971838
Alignment:
| Q |
3 |
gccgtcacaatcattctcttcttctcgcaactcattctcaatttcgatgaaaatcataaaggnnnnnnnttatgcagggcacattgggaggacccagata |
102 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
49971939 |
gccgtcacaatcatcctcttcttctcgcaactcattctcaatttcgatgaaaatcataaaggaaaaaaattatgcagggcacattgggaggacccagata |
49971840 |
T |
 |
| Q |
103 |
tt |
104 |
Q |
| |
|
|| |
|
|
| T |
49971839 |
tt |
49971838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University