View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0263_low_31 (Length: 208)

Name: NF0263_low_31
Description: NF0263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0263_low_31
NF0263_low_31
[»] chr2 (1 HSPs)
chr2 (1-128)||(10178278-10178405)
[»] chr1 (1 HSPs)
chr1 (38-81)||(2043021-2043064)


Alignment Details
Target: chr2 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 1 - 128
Target Start/End: Complemental strand, 10178405 - 10178278
Alignment:
1 aacaaaagtacaagcaaacttaaaatatatgtatctgatttcttttggtttgattcaattttgaaaaaggaatctaaaatttgatctcaatgatcagttt 100  Q
    ||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
10178405 aacaaaagtacaatcaaacttaaaatatatgtatccgatttcttttggtttgattcaattttgaaaaaggaatctaaaatttgatctcaatgatcaattt 10178306  T
101 caattcctgtcaattgtcatgcttatat 128  Q
    ||||||||||||||||||||||||||||    
10178305 caattcctgtcaattgtcatgcttatat 10178278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 38 - 81
Target Start/End: Complemental strand, 2043064 - 2043021
Alignment:
38 atttcttttggtttgattcaattttgaaaaaggaatctaaaatt 81  Q
    ||||| |||||||||||||| |||||||||||||||| ||||||    
2043064 atttcatttggtttgattcagttttgaaaaaggaatccaaaatt 2043021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University