View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0263_low_31 (Length: 208)
Name: NF0263_low_31
Description: NF0263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0263_low_31 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 1 - 128
Target Start/End: Complemental strand, 10178405 - 10178278
Alignment:
| Q |
1 |
aacaaaagtacaagcaaacttaaaatatatgtatctgatttcttttggtttgattcaattttgaaaaaggaatctaaaatttgatctcaatgatcagttt |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
10178405 |
aacaaaagtacaatcaaacttaaaatatatgtatccgatttcttttggtttgattcaattttgaaaaaggaatctaaaatttgatctcaatgatcaattt |
10178306 |
T |
|
| Q |
101 |
caattcctgtcaattgtcatgcttatat |
128 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
10178305 |
caattcctgtcaattgtcatgcttatat |
10178278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 38 - 81
Target Start/End: Complemental strand, 2043064 - 2043021
Alignment:
| Q |
38 |
atttcttttggtttgattcaattttgaaaaaggaatctaaaatt |
81 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
2043064 |
atttcatttggtttgattcagttttgaaaaaggaatccaaaatt |
2043021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 803 times since January 2019
Visitors: 2568