View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0263_low_32 (Length: 208)
Name: NF0263_low_32
Description: NF0263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0263_low_32 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 9136353 - 9136146
Alignment:
| Q |
1 |
aaaacattccgttgtaagggaatgagcaatgggcaataatgatggagcaggttctagatctcttatgtgtcccactgtatttaaaccatttactgactaa |
100 |
Q |
| |
|
|||||||||| || |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| | |
|
|
| T |
9136353 |
aaaacattccattttaagtgaatgagcaatgggcaataatgatggagcaggttctagatctcttatgtgtcccactgcatttaaaccattcactgactga |
9136254 |
T |
|
| Q |
101 |
atttatttactagtagtaccattttcgcatgcatttggctcgagctgacataaaacgatacggcattgaagaaaagcatgaagtagggttggaggagatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
9136253 |
atttatttactagtagtaccattttcgcatgcatttggctcgagctgacataaaacgataaggcattgaagaaaagcatgaagttgggttggaggagatt |
9136154 |
T |
|
| Q |
201 |
gaaagagc |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
9136153 |
gaaagagc |
9136146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 618 times since January 2019
Visitors: 2567