View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0263_low_32 (Length: 208)

Name: NF0263_low_32
Description: NF0263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0263_low_32
NF0263_low_32
[»] chr7 (1 HSPs)
chr7 (1-208)||(9136146-9136353)


Alignment Details
Target: chr7 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 9136353 - 9136146
Alignment:
1 aaaacattccgttgtaagggaatgagcaatgggcaataatgatggagcaggttctagatctcttatgtgtcccactgtatttaaaccatttactgactaa 100  Q
    |||||||||| || |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| |    
9136353 aaaacattccattttaagtgaatgagcaatgggcaataatgatggagcaggttctagatctcttatgtgtcccactgcatttaaaccattcactgactga 9136254  T
101 atttatttactagtagtaccattttcgcatgcatttggctcgagctgacataaaacgatacggcattgaagaaaagcatgaagtagggttggaggagatt 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||    
9136253 atttatttactagtagtaccattttcgcatgcatttggctcgagctgacataaaacgataaggcattgaagaaaagcatgaagttgggttggaggagatt 9136154  T
201 gaaagagc 208  Q
    ||||||||    
9136153 gaaagagc 9136146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 618 times since January 2019
Visitors: 2567