View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0263_low_33 (Length: 207)
Name: NF0263_low_33
Description: NF0263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0263_low_33 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 97 - 207
Target Start/End: Complemental strand, 41276832 - 41276721
Alignment:
| Q |
97 |
aatatcactaaaatgagaggggcaaaatttaaagattacaaagtcatcagaaatttctacaaaataggatctatt-ccataaccatgtaaactcaacttc |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41276832 |
aatatcactaaaatgagaggggcaaaatttaaagattacaaagtcatcagaaatttctacaaaataggatctattcccataaccatgtaaactcaacttc |
41276733 |
T |
 |
| Q |
196 |
atgatttaacta |
207 |
Q |
| |
|
|||||||||||| |
|
|
| T |
41276732 |
atgatttaacta |
41276721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University