View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0263_low_34 (Length: 201)

Name: NF0263_low_34
Description: NF0263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0263_low_34
NF0263_low_34
[»] chr4 (1 HSPs)
chr4 (1-116)||(30877827-30877942)


Alignment Details
Target: chr4 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 30877942 - 30877827
Alignment:
1 aacacctctccttattccattgtttccaaggttgtctcctgtgtttggtccccacaaacaactctcctttttcatttctcttttcactttgctatggaaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30877942 aacacctctccttattccattgtttccaaggttgtctcctgtgtttggtccccacaaacaactctcctttttcatttctcttttcactttgctatggaaa 30877843  T
101 tggaaggttatgatat 116  Q
    ||||||||||||||||    
30877842 tggaaggttatgatat 30877827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University