View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0263_low_34 (Length: 201)
Name: NF0263_low_34
Description: NF0263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0263_low_34 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 30877942 - 30877827
Alignment:
| Q |
1 |
aacacctctccttattccattgtttccaaggttgtctcctgtgtttggtccccacaaacaactctcctttttcatttctcttttcactttgctatggaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30877942 |
aacacctctccttattccattgtttccaaggttgtctcctgtgtttggtccccacaaacaactctcctttttcatttctcttttcactttgctatggaaa |
30877843 |
T |
|
| Q |
101 |
tggaaggttatgatat |
116 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
30877842 |
tggaaggttatgatat |
30877827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University