View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0263_low_36 (Length: 201)

Name: NF0263_low_36
Description: NF0263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0263_low_36
NF0263_low_36
[»] chr2 (1 HSPs)
chr2 (1-121)||(12694228-12694348)
[»] chr4 (1 HSPs)
chr4 (48-92)||(42448085-42448129)


Alignment Details
Target: chr2 (Bit Score: 117; Significance: 8e-60; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 1 - 121
Target Start/End: Original strand, 12694228 - 12694348
Alignment:
1 aataagaaattgatttaacatgatcagcagaacaacatccggtgcaatgaagagtgatgacttctagcagtttgatgttctatgtgagggcacatatcat 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
12694228 aataagaaattgatttaacatgatcagcagaacaacatccggtgcaatgaagagtgatgacttctagcagtttgatgttctatgcgagggcacatatcat 12694327  T
101 gccgtgggaactttatattgt 121  Q
    |||||||||||||||||||||    
12694328 gccgtgggaactttatattgt 12694348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 48 - 92
Target Start/End: Complemental strand, 42448129 - 42448085
Alignment:
48 tgaagagtgatgacttctagcagtttgatgttctatgtgagggca 92  Q
    |||||||||| |||||  ||||||||||||||||||| |||||||    
42448129 tgaagagtgacgactttgagcagtttgatgttctatgcgagggca 42448085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University