View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0263_low_6 (Length: 323)
Name: NF0263_low_6
Description: NF0263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0263_low_6 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 67 - 323
Target Start/End: Complemental strand, 43410937 - 43410681
Alignment:
| Q |
67 |
gctgttgcggaaagtgtttggaagattgagaggggaagcttgaaaaagagagagtctaatggtacgtgtgtgagatgatgtgtgcaagtctttacattct |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43410937 |
gctgttgcggaaagtgtttggaagattgagaggggaagcttgaaaaagagagagtctaatggtacgtgtgtgagatgatgtgtgcaagtctttacattct |
43410838 |
T |
|
| Q |
167 |
tcaagatcagcatcacatgataacacaacccattctccttcatcatccaaatattttagaaccaagttgttcatatctgttaggttaaatcgccttgcaa |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43410837 |
tcaagatcagcatcacatgataacacaacccattctccttcatcatccaaatattttagaaccaagttgttcatatctgttaggttaaatcgccttgcaa |
43410738 |
T |
|
| Q |
267 |
tctcaagctgcaaatctctaaatccccacattgcttgcaagctaaacctgatttttt |
323 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43410737 |
tctcaagctgcaaatctctaaatccccacattgcttgcaagctaaacctgatttttt |
43410681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 790 times since January 2019
Visitors: 2568