View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0266_high_12 (Length: 245)
Name: NF0266_high_12
Description: NF0266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0266_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 27 - 147
Target Start/End: Original strand, 3724428 - 3724548
Alignment:
Q |
27 |
acttccactttactgtaattggagctaggctttacaacctttggagcaacggaagaaacatagagnnnnnnntgtcatgaccacatttgtaaataacaaa |
126 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
3724428 |
acttccactttactgtaattggagctaggctttacaacctttggagcaacgaaagaaacatagagaaaaaaatgtcatgaccacatttgtaaataacaaa |
3724527 |
T |
 |
Q |
127 |
agatgtagttaatagttatat |
147 |
Q |
|
|
||||||||||||||||||||| |
|
|
T |
3724528 |
agatgtagttaatagttatat |
3724548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University