View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0266_low_14 (Length: 245)

Name: NF0266_low_14
Description: NF0266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0266_low_14
NF0266_low_14
[»] chr4 (1 HSPs)
chr4 (27-147)||(3724428-3724548)


Alignment Details
Target: chr4 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 27 - 147
Target Start/End: Original strand, 3724428 - 3724548
Alignment:
27 acttccactttactgtaattggagctaggctttacaacctttggagcaacggaagaaacatagagnnnnnnntgtcatgaccacatttgtaaataacaaa 126  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||       ||||||||||||||||||||||||||||    
3724428 acttccactttactgtaattggagctaggctttacaacctttggagcaacgaaagaaacatagagaaaaaaatgtcatgaccacatttgtaaataacaaa 3724527  T
127 agatgtagttaatagttatat 147  Q
    |||||||||||||||||||||    
3724528 agatgtagttaatagttatat 3724548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University