View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0266_low_7 (Length: 269)
Name: NF0266_low_7
Description: NF0266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0266_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 43 - 207
Target Start/End: Original strand, 4094103 - 4094267
Alignment:
| Q |
43 |
cattaacaatttcaataaatatgtatgtatgtggataaagaatcagcgccttaatcacaacaagagtgtccataatatggatcaagttggtaagatattt |
142 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4094103 |
cattaacaatttcaataaatatgtatgtaggtggataaagaatcagcaccttaatcacaacaagagtgtccataatatggatcaagttggtaagatattt |
4094202 |
T |
|
| Q |
143 |
tgtgtgattttgtctaaaaattgcaaggttaagaagagttaagacaactcttgcatgtgtacatc |
207 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4094203 |
tgtgtgactttgtctaaaaattgcaaggttaagaagagttaagacaactcttgcatgtgtacatc |
4094267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 753 times since January 2019
Visitors: 2568