View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0267_high_5 (Length: 327)
Name: NF0267_high_5
Description: NF0267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0267_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 5e-84; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 5e-84
Query Start/End: Original strand, 6 - 191
Target Start/End: Complemental strand, 53701115 - 53700930
Alignment:
Q |
6 |
aggagcagagatcgatggaaaatatgaatgatgaagaatcaaccgtgaaacaaggaagcggtggtggtgaaaatcatgtaagaagaacagaaagtgtgga |
105 |
Q |
|
|
|||| |||| |||||| ||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
53701115 |
aggaccagaaatcgatagaaaatatgaatgatgaagaatcaaccgtgaaacaaggagggggtggtggtgaaaatcatgtaagaagaacagaaagtgtgga |
53701016 |
T |
 |
Q |
106 |
aacaccaacaacagacacatcttaagatcagaacgtttgatatgattaatcatgtttaatggagtttttgcatgttccgtaattgg |
191 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
53701015 |
aacaccaacaacagacacatcttaagataagaacgtttgatatgattaatcatgtttaatggagtttttgcatgttccgtgattgg |
53700930 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 256 - 327
Target Start/End: Complemental strand, 53700875 - 53700804
Alignment:
Q |
256 |
ccttctcttctttttatgggacatgtgtaattttcttcaatatctacaaagtacaactgtacattgatattt |
327 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
53700875 |
ccttctcttctttttatgggacatgtgtaattttcttcaatatctacaaagtacaactgtacattgatattt |
53700804 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University
This website was viewed 495 times since January 2019
Visitors: 8221