View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0267_high_7 (Length: 307)
Name: NF0267_high_7
Description: NF0267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0267_high_7 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 1e-81; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 142 - 307
Target Start/End: Complemental strand, 41795351 - 41795186
Alignment:
| Q |
142 |
ataaatattatcttttcaaccttttcttgtacttctttttcctctactgcagcactgtgttcatctgcgtcattagttctcatctcaacttctctctcca |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41795351 |
ataaatattatcttttcaaccttttcttgtacttctttttcctctactgcagcattgtgttcatctgcttcattagttctcatctcaacttctctctcca |
41795252 |
T |
|
| Q |
242 |
acaatggctcgttcacctcaacatcaagaacatgagaccgtgaacaaatttcttcttctttttctt |
307 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41795251 |
acaatggctcattcacctcaacatcaagaacatgagaccgtgaacaaatttcttcttctttttctt |
41795186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1052 times since January 2019
Visitors: 2571