View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0267_high_8 (Length: 301)

Name: NF0267_high_8
Description: NF0267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0267_high_8
NF0267_high_8
[»] chr6 (1 HSPs)
chr6 (126-277)||(30128252-30128403)


Alignment Details
Target: chr6 (Bit Score: 144; Significance: 1e-75; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 126 - 277
Target Start/End: Original strand, 30128252 - 30128403
Alignment:
126 gagtgagatgaacacaaaataaagtatatagtgatgaaaattttgtgctgggatcccgaatattgtctcttgaggtagtgtgtgccccattatccctcaa 225  Q
    |||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30128252 gagtgaaaagaacacaaaataaagtatatagtgatgaaaattttgtgctgggatcccgaatattgtctcttgaggtagtgtgtgccccattatccctcaa 30128351  T
226 atgtctgcgcttcttctgttgtttgctccagattctgttctggtttttctta 277  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
30128352 atgtctgcgcttcttctgttgtttgctccagattctgttctggtttttctta 30128403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 386 times since January 2019
Visitors: 2564