View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0267_low_24 (Length: 230)

Name: NF0267_low_24
Description: NF0267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0267_low_24
NF0267_low_24
[»] chr6 (1 HSPs)
chr6 (55-206)||(30128252-30128403)


Alignment Details
Target: chr6 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 55 - 206
Target Start/End: Original strand, 30128252 - 30128403
Alignment:
55 gagtgagatgaacacaaaataaagtatatagtgatgaaaattttgtgctgggatcccgaatattgtctcttgaggtagtgtgtgccccattatccctcaa 154  Q
    |||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30128252 gagtgaaaagaacacaaaataaagtatatagtgatgaaaattttgtgctgggatcccgaatattgtctcttgaggtagtgtgtgccccattatccctcaa 30128351  T
155 atgtctgcgcttcttctgttgtttgctccagattctgttctggtttttctta 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
30128352 atgtctgcgcttcttctgttgtttgctccagattctgttctggtttttctta 30128403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 711 times since January 2019
Visitors: 2568