View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0267_low_27 (Length: 226)
Name: NF0267_low_27
Description: NF0267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0267_low_27 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 51 - 202
Target Start/End: Original strand, 30128252 - 30128403
Alignment:
Q |
51 |
gagtgagatgaacacaaaataaagtatatagtgatgaaaattttgtgctgggatcccgaatattgtctcttgaggtagtgtgtgccccattatccctcaa |
150 |
Q |
|
|
|||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30128252 |
gagtgaaaagaacacaaaataaagtatatagtgatgaaaattttgtgctgggatcccgaatattgtctcttgaggtagtgtgtgccccattatccctcaa |
30128351 |
T |
 |
Q |
151 |
atgtctgcgcttcttctgttgtttgctccagattctgttctggtttttctta |
202 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30128352 |
atgtctgcgcttcttctgttgtttgctccagattctgttctggtttttctta |
30128403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1059 times since January 2019
Visitors: 2571