View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0267_low_39 (Length: 204)
Name: NF0267_low_39
Description: NF0267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0267_low_39 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 26 - 177
Target Start/End: Complemental strand, 30128403 - 30128252
Alignment:
Q |
26 |
taagaaaaaccagaacagaatctggagcaaacaacagaagaagcgcagacatttgagggataatggggcacacactacctcaagagaaaatattcgggat |
125 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
30128403 |
taagaaaaaccagaacagaatctggagcaaacaacagaagaagcgcagacatttgagggataatggggcacacactacctcaagagacaatattcgggat |
30128304 |
T |
 |
Q |
126 |
cccagcacaaaattttcatcactatatactttattttgtgttcatctcactc |
177 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
T |
30128303 |
cccagcacaaaattttcatcactatatactttattttgtgttcttttcactc |
30128252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University