View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0268_high_4 (Length: 256)
Name: NF0268_high_4
Description: NF0268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0268_high_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 18 - 222
Target Start/End: Complemental strand, 6889575 - 6889371
Alignment:
| Q |
18 |
gagatgaaaccctaatttctcctttcaactcttctgaatcatggttgaatttacctggaaatgatatattatgttcaacaaagtttcaacttgctgttga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6889575 |
gagatgaaaccctaatttctcctttcaactcttctgaatcatggctgaatttacctggaaatgatatattatgttcaacaaagtttcaacttgctgttga |
6889476 |
T |
|
| Q |
118 |
taattttgatcaaaaagtctccaaaggtataatagatgctaggtttcgagataaagggggaaacgacgatgaaagtgatgtagctatgagcttgaatttg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6889475 |
taattttgatcaaaaagtctccaaaggtataatagatgctaggtttcgagataaagggggaaacgacgatgaaagtgatgtagctatgagcttgaatttg |
6889376 |
T |
|
| Q |
218 |
gtttt |
222 |
Q |
| |
|
||||| |
|
|
| T |
6889375 |
gtttt |
6889371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 519 times since January 2019
Visitors: 2566