View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0268_high_8 (Length: 209)
Name: NF0268_high_8
Description: NF0268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0268_high_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 82; Significance: 7e-39; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 24 - 109
Target Start/End: Complemental strand, 5922846 - 5922761
Alignment:
| Q |
24 |
ctaataatggactagagttgttgtagtgaagaaattaaaactcaatataaaccttcttatttataaaaactttctacctttgcttc |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5922846 |
ctaataatggactagagttgttgtagtgaagaaattaaaactcaatataaaccttcttatttataaaaactttctaccttttcttc |
5922761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 207 times since January 2019
Visitors: 2563