View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0268_low_1 (Length: 444)
Name: NF0268_low_1
Description: NF0268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0268_low_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-118; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 102 - 368
Target Start/End: Original strand, 40046674 - 40046941
Alignment:
| Q |
102 |
aatagataatgtcaatccatttat-atttgttgagacatagtcgaatttagataaatgccaaccctaatagatatattacttttgttaatacagtagtcg |
200 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
40046674 |
aatagataatgtcaatccatttaacatttgttgagacatagtcgaatttagataaatgccaaccctaatagatatattacttttgttaatacagtaatcg |
40046773 |
T |
|
| Q |
201 |
ggtaagacccgacaactgtcttaatggttgcgatatgatcaaggttgatcttttaatcaatggagaatgctagatttcaggtttgattcttccaatgtta |
300 |
Q |
| |
|
| ||||||| |||||||||||||||||||| || |||||||| |||| ||||||||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40046774 |
gataagacctgacaactgtcttaatggttgagacatgatcaaagttggtcttttaattaatggagaatgctagattttaggtttgattcttccaatgtta |
40046873 |
T |
|
| Q |
301 |
atttaggtatgctagtttaacttcttaaatattttttatcacgactcctctgcatcaatttgatgatg |
368 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40046874 |
atttagatatgctagtttaacttcttaaatattttttatcacgactcctctgcatcaatttgatgatg |
40046941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 40046571 - 40046607
Alignment:
| Q |
1 |
aaaattatctaagaacaaggc-tttttaaaattaata |
36 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40046571 |
aaaattatctaagaacaaggcttttttaaaattaata |
40046607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 303 times since January 2019
Visitors: 2564