View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0268_low_10 (Length: 287)
Name: NF0268_low_10
Description: NF0268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0268_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 83; Significance: 2e-39; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 100 - 190
Target Start/End: Original strand, 27940062 - 27940152
Alignment:
| Q |
100 |
ctgtgcaaaaaagctacttgaatgaagatgttagagaaggatattttgcagtggttgcaatcaaagatggagaaatgaaaaggtttatgat |
190 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27940062 |
ctgttcaaaaaagccacttgaatgaagatgttagagaaggatattttgcagtggttgcaatcaaagatggagaaatgaaaaggtttatgat |
27940152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 123 - 187
Target Start/End: Original strand, 27956174 - 27956238
Alignment:
| Q |
123 |
gaagatgttagagaaggatattttgcagtggttgcaatcaaagatggagaaatgaaaaggtttat |
187 |
Q |
| |
|
||||||||||| |||||||| ||||| || |||||||| || |||||||||| ||||||||||| |
|
|
| T |
27956174 |
gaagatgttagggaaggatactttgctgttgttgcaatgaaggatggagaaactaaaaggtttat |
27956238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 123 - 187
Target Start/End: Original strand, 27959359 - 27959423
Alignment:
| Q |
123 |
gaagatgttagagaaggatattttgcagtggttgcaatcaaagatggagaaatgaaaaggtttat |
187 |
Q |
| |
|
||||||||||| |||||||| ||||| || |||||||| ||||||||||||| |||| |||||| |
|
|
| T |
27959359 |
gaagatgttagggaaggatactttgctgtcgttgcaatgaaagatggagaaaccaaaaagtttat |
27959423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 757 times since January 2019
Visitors: 2568