View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0268_low_19 (Length: 206)

Name: NF0268_low_19
Description: NF0268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0268_low_19
NF0268_low_19
[»] chr7 (1 HSPs)
chr7 (1-204)||(40929302-40929505)


Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 40929505 - 40929302
Alignment:
1 gatgtcttgtttttggaaaggtttgtagagatttagaaccaaaaccaatcgtttttcgtgaaattctccaaaatatcagtactcgaaacattcttacttt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40929505 gatgtcttgtttttggaaaggtttgtagagatttagaaccaaaaccaatcgtttttcgtgaaattctccaaaatatcagtactcgaaacattcttacttt 40929406  T
101 cacaatatgaataagtccactagtatctttaggcactaaatatgcttcagactatgaggaccttgccagtagttgctatcattgataatgcctatgtttg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40929405 cacaatatgaataagtccactagtatctttaggcactaaatatgcttcagactatgaggaccttgccagtagttgctatcattgataatgcctatgtttg 40929306  T
201 atga 204  Q
    ||||    
40929305 atga 40929302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 965 times since January 2019
Visitors: 2569