View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0268_low_3 (Length: 372)
Name: NF0268_low_3
Description: NF0268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0268_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 87 - 306
Target Start/End: Original strand, 718165 - 718384
Alignment:
| Q |
87 |
aggttgagataattagtaatttgaagcataggaatctgttacctcttagaggttgttgtgtggttgatgaaaatgagaattatggtgataaaggaagtca |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
718165 |
aggttgagataattagtaatttgaagcataggaatctgttacctcttagaggttgttgtgtggttgatgaaaatgagaattatggtgataaaggaagtca |
718264 |
T |
 |
| Q |
187 |
aagataccttgtttatgattacatgccaaatggaaacttggaagatcatctttttgtatcaaaggatcctcaaaaagcaaacaaatcgttgtcgtggccg |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
718265 |
aagataccttgtttatgattacatgccaaatggaaacttggaagatcatctttttgtatcaaaggatcctcaaaaagcaaacaaatcgttgtcgtggccg |
718364 |
T |
 |
| Q |
287 |
cttcggaaaaacatattctt |
306 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
718365 |
cttcggaaaaacataatctt |
718384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University