View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0268_low_4 (Length: 368)
Name: NF0268_low_4
Description: NF0268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0268_low_4 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 53 - 368
Target Start/End: Complemental strand, 45671848 - 45671529
Alignment:
| Q |
53 |
gatggacatcatcatgtcatggctgccagtgctgttgaacttcttactgacttggtcaaggctttacaggcagtcaatgctactgcatggcacaatgctt |
152 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45671848 |
gatggtcatcatcatgtcatggctgccagtgctgttgaacttcttactgacttggtcaaggctttacaggcagtcaatgctactgcatggcacaatgctt |
45671749 |
T |
|
| Q |
153 |
ttttaggtttatggtttgctgccctgcgactcgttcaaagggtaagaaatactaactt----cagccaattgattaactcaaatatgttctggttgctca |
248 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45671748 |
ttttaggtttatggtttgctgccctgcggctcgttcaacgggtaagaaatactaacttgtttcagccaattgattaactcaaatctgttctggttgctca |
45671649 |
T |
|
| Q |
249 |
tttatgtgccagacactgcattgtccacgagcttacaaatgtgtaacatgtggtcaaatgcagattttttagccataaaaattaaagaaaatatagcatg |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45671648 |
tttatgtgccagacactgcattgtccacgagcttacaaatgtgtaacatgtggtcaaatgcagattttttagccataaaaattaaagaaaatatagcatg |
45671549 |
T |
|
| Q |
349 |
tcaatttaccttctttgtaa |
368 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
45671548 |
tcaatttaccttctttgtaa |
45671529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 496 times since January 2019
Visitors: 2566