View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0268_low_6 (Length: 323)
Name: NF0268_low_6
Description: NF0268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0268_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 100 - 268
Target Start/End: Original strand, 7456973 - 7457141
Alignment:
| Q |
100 |
caaagtgctcttttgttttcgtgtcagtttgtcatcgtcaaaacatcaataacgtatagtttgtatatgtaccgatttctaacaattgtgtgtgtcgtaa |
199 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7456973 |
caaagtgctcttttgtttttgtgtcagtttgtcatcgtcaaaacatcaataacgtatagtttgtatatgtacctatttctaacaattgtgtgtgtcgtaa |
7457072 |
T |
 |
| Q |
200 |
atgttaattacaattagtatttataggcagagctcgcatcttgctagttaagacattatggtctacaaa |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7457073 |
atgttaattacaattagtatttataggcagagctcgcatcttgctggttaagacattatggtctacaaa |
7457141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 188 - 241
Target Start/End: Complemental strand, 13219802 - 13219749
Alignment:
| Q |
188 |
tgtgtgtcgtaaatgttaattacaattagtatttataggcagagctcgcatctt |
241 |
Q |
| |
|
|||||||| ||||||||| |||||| |||||||||||| ||| |||||||||| |
|
|
| T |
13219802 |
tgtgtgtccaaaatgttaagtacaatgagtatttataggtagaactcgcatctt |
13219749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University