View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0268_low_7 (Length: 319)

Name: NF0268_low_7
Description: NF0268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0268_low_7
NF0268_low_7
[»] chr7 (1 HSPs)
chr7 (149-240)||(40511863-40511954)


Alignment Details
Target: chr7 (Bit Score: 92; Significance: 1e-44; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 149 - 240
Target Start/End: Complemental strand, 40511954 - 40511863
Alignment:
149 gtctcaaataatcacttaatcagtaatgatttctcacctaagtatacttgttttccacaatccctgcagaaaaacgaaaacagagtggattc 240  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40511954 gtctcaaataatcacttaatcagtaatgatttctcacctaagtatacttgttttccacaatccctgcagaaaaacgaaaacagagtggattc 40511863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University