View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0268_low_7 (Length: 319)
Name: NF0268_low_7
Description: NF0268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0268_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 92; Significance: 1e-44; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 149 - 240
Target Start/End: Complemental strand, 40511954 - 40511863
Alignment:
Q |
149 |
gtctcaaataatcacttaatcagtaatgatttctcacctaagtatacttgttttccacaatccctgcagaaaaacgaaaacagagtggattc |
240 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40511954 |
gtctcaaataatcacttaatcagtaatgatttctcacctaagtatacttgttttccacaatccctgcagaaaaacgaaaacagagtggattc |
40511863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University