View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0268_low_8 (Length: 307)
Name: NF0268_low_8
Description: NF0268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0268_low_8 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 68 - 307
Target Start/End: Original strand, 24300268 - 24300507
Alignment:
| Q |
68 |
gattatactgtattttaaaaagaagtattggactgatgggagcagtttcatctagctcaattgtttattgtcagcttgctggatttggagtttagatctc |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
24300268 |
gattatactgtattttaaaaagaagtattggactgatgggagcagtttcatctagctctattgtttattgtcagcttgctgtatttagagtttagatctc |
24300367 |
T |
|
| Q |
168 |
ttggtttatgttgcaagttctcgtagctactctcattgaatgtaggagtaatttcatgggacctttagaagtgcgattgttgattgggcggggtggttct |
267 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| || |
|
|
| T |
24300368 |
ttggtttatgttgcaagttttcgtagctactctcattgaatgtaggagtaatttcatgggaccttcagaagtgcgattggtgattgggcggggtggtgct |
24300467 |
T |
|
| Q |
268 |
tggtttgatcttgttattttacgggggagtgtgctatttt |
307 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24300468 |
tggtttgatcttgttattttaagggggagtgtgctatttt |
24300507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 270 times since January 2019
Visitors: 2563