View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0269_low_11 (Length: 329)
Name: NF0269_low_11
Description: NF0269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0269_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 42 - 83
Target Start/End: Original strand, 38455204 - 38455245
Alignment:
| Q |
42 |
atgaatgatagggtgcaacatcaatggtgcgtttgttccatc |
83 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38455204 |
atgaatgatagggtgcaacatcaatggtgcgtttgttccatc |
38455245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University